| Worm | |
|---|---|
| # of mRNA - piRNA pairing | 2230495 |
| # of transposable_element_ncRNA - piRNA pairing | 0 |
| # of Transposon-mRNA - piRNA pairing | 26802 |
| # of 7kncRNA - piRNA pairing | 11304 |
| # of ncRNA - piRNA pairing | 7302 |
| # of circRNA - piRNA pairing | 50488 |
| # of tRNA - piRNA pairing | 34964 |
| # of miRNA - piRNA pairing | 22 |
| # of snoRNA - piRNA pairing | 3949 |
| # of lincRNA - piRNA pairing | 6090 |
| # of snRNA - piRNA pairing | 21154 |
| # of asRNA - piRNA pairing | 830 |
| # of rRNA - piRNA pairing | 22038 |
| # of miRNA_primary_transcript - piRNA pairing | 2171 |
| # of scRNA - piRNA pairing | 140 |
| # of non coding transcript - piRNA pairing | 42258 |
| # of pre_miRNA - piRNA pairing | 1545 |
| # of all pairing | 2461552 |
CLASH data of C. elegans: young adult hermaphrodite, N2 background
| SRR6512652 | SRR6512653 |
Barcode, Adapter and Unique Reads for C.elegans
| File Name | Barcode | 3'Adapter | Unique Reads | Unique Hybrid Reads identified by ChiRa |
|---|---|---|---|---|
| SRR6512652 | No Barcode | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA | 6388266 | 2039679 |
| SRR6512653 |
| File Name | Sample | Barcode | 3'Adapter | Unique Reads |
|---|---|---|---|---|
| SRR8482951 | WT_WAGOIP | No Barcode | TGGAATTCTCGGGTGCCAAGG | 487012 |
| SRR8482949 | PRG_MUT_WAGOIP | No Barcode | TGGAATTCTCGGGTGCCAAGG | 124412 |
| SRR12567597 | HRDE1IP | No Barcode | TGGAATTCTCGGGTGCCAAGG | 878882 |
| SRR12567605 | PRG_MUT_HRDE1IP | No Barcode | TGGAATTCTCGGGTGCCAAGG | 717200 |